Biopython MCP
MCP interface to BioPython
Installation
npx biopython-mcpAsk AI about Biopython MCP
Powered by Claude · Grounded in docs
I know everything about Biopython MCP. Ask me about installation, configuration, usage, or troubleshooting.
0/500
Reviews
Documentation
BioPython MCP Server
A Model Context Protocol (MCP) server that provides comprehensive BioPython capabilities for biological sequence analysis, alignment, database access, and structural bioinformatics.
Overview
BioPython MCP bridges the powerful BioPython library with MCP-enabled applications like Claude Desktop, allowing seamless integration of bioinformatics tools into AI-assisted workflows. This enables researchers, clinicians, and developers to perform complex biological analyses through natural language interfaces.
Motivation
Bioinformatics workflows often require switching between multiple tools and writing custom scripts. BioPython MCP simplifies this by:
- Unified Interface: Access BioPython's capabilities through a standardized MCP protocol
- AI Integration: Combine computational biology with AI-powered analysis and interpretation
- Workflow Automation: Chain complex bioinformatics tasks through conversational interfaces
- Accessibility: Make advanced bioinformatics tools available to non-programmers
Features
-
Sequence Operations
- DNA/RNA translation and transcription
- Reverse complement calculation
- GC content analysis
- Motif finding and pattern matching
-
Sequence Alignment
- Pairwise global and local alignment
- Multiple sequence alignment support
- Alignment scoring with substitution matrices
-
Database Access
- GenBank sequence retrieval
- UniProt protein data access
- PubMed literature search
- NCBI database queries
-
Protein Structure Analysis
- PDB structure fetching and parsing
- Structure statistics calculation
- Active site residue analysis
-
Phylogenetics
- Phylogenetic tree construction (NJ, UPGMA)
- Distance matrix calculation
- Tree visualization
Installation
Requirements
- Python 3.10 or higher
- pip or uv package manager
Quick Install with uvx (Recommended)
The fastest way to run BioPython MCP without installation:
uvx biopython-mcp
Or run from source:
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uvx --from . biopython-mcp
Install from PyPI
pip install biopython-mcp
Install from Source with uv
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uv venv --python 3.10
source .venv/bin/activate # On Windows: .venv\Scripts\activate
uv pip install -e ".[dev]"
Install from Source with pip
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
pip install -e ".[dev]"
Development Installation
For contributing or development:
git clone https://github.com/kmaneesh/biopython-mcp.git
cd biopython-mcp
uv venv --python 3.10
source .venv/bin/activate
uv pip install -e ".[dev]"
pre-commit install
Quick Start
Running the Server
Start the MCP server:
# With uvx (no installation needed)
uvx biopython-mcp
# Or if installed
biopython-mcp
Configuration for Claude Desktop
Add to your Claude Desktop configuration file:
macOS: ~/Library/Application Support/Claude/claude_desktop_config.json
Windows: %APPDATA%\Claude\claude_desktop_config.json
Using uvx (recommended):
{
"mcpServers": {
"biopython": {
"command": "uvx",
"args": ["biopython-mcp"],
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}
Using installed package:
{
"mcpServers": {
"biopython": {
"command": "biopython-mcp",
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}
Using local development version:
{
"mcpServers": {
"biopython": {
"command": "uvx",
"args": ["--from", "/path/to/biopython-mcp", "biopython-mcp"],
"env": {
"NCBI_EMAIL": "you@example.com",
"NCBI_API_KEY": "your_ncbi_api_key",
"OBSIDIAN_VAULT_PATH": "/Users/yourname/Documents/ObsidianVault"
}
}
}
}
Basic Usage Example
Once configured, you can use BioPython tools through Claude Desktop:
User: Translate the DNA sequence ATGGCCATTGTAATGGGCCGC to protein
Claude: [Uses translate_sequence tool]
Result: MAIVMGR (7 amino acids)
User: What's the GC content of this sequence?
Claude: [Uses calculate_gc_content tool]
Result: 57.14% GC content
Available Tools
Sequence Operations
| Tool | Description |
|---|---|
translate_sequence | Translate DNA/RNA to protein |
reverse_complement | Get reverse complement of DNA |
transcribe_dna | Transcribe DNA to RNA |
calculate_gc_content | Calculate GC percentage |
find_motif | Find sequence motifs |
Alignment
| Tool | Description |
|---|---|
pairwise_align | Align two sequences |
multiple_sequence_alignment | Align multiple sequences |
calculate_alignment_score | Score alignments |
Database Access
| Tool | Description |
|---|---|
fetch_genbank | Retrieve GenBank records |
fetch_uniprot | Retrieve UniProt entries |
search_pubmed | Search PubMed literature |
fetch_sequence_by_id | Get sequences by ID |
Structure Analysis
| Tool | Description |
|---|---|
fetch_pdb_structure | Download PDB structures |
calculate_structure_stats | Analyze structure statistics |
find_active_site | Extract active site info |
Phylogenetics
| Tool | Description |
|---|---|
build_phylogenetic_tree | Build phylogenetic trees |
calculate_distance_matrix | Compute distance matrices |
draw_tree | Visualize trees |
See the Tools Reference for detailed documentation.
Configuration Options
Environment Variables
NCBI_EMAIL: Email address for NCBI Entrez queries (recommended)NCBI_API_KEY: API key for higher NCBI rate limits (optional)OBSIDIAN_VAULT_PATH: Path to your Obsidian vault root directory (optional, for pubmed_review)- When set, the LLM will determine the directory path and filename for saving literature reviews
- Can be overridden per-call with the
obsidian_vaultparameter
Setting Environment Variables
export NCBI_EMAIL="your.email@example.com"
export NCBI_API_KEY="your_api_key_here"
export OBSIDIAN_VAULT_PATH="/Users/yourname/Documents/ObsidianVault"
Examples
Analyze a Gene Sequence
# 1. Fetch from GenBank
fetch_genbank(accession="NM_000207", email="user@example.com")
# 2. Calculate GC content
calculate_gc_content(sequence="ATGGCC...")
# 3. Translate to protein
translate_sequence(sequence="ATGGCC...")
# 4. Find start codons
find_motif(sequence="ATGGCC...", motif="ATG")
Compare Sequences
# Perform global alignment
pairwise_align(
seq1="ATGGCCATTGTAATGGGCCGC",
seq2="ATGGCCATTGTTATGGGCCGC",
mode="global"
)
Build Phylogenetic Tree
# Build tree from aligned sequences
build_phylogenetic_tree(
sequences=["ATGGCC...", "ATGGCT...", "ATGGCA..."],
method="nj",
labels=["Species_A", "Species_B", "Species_C"]
)
See examples/ for complete workflow examples.
Documentation
Contributing
We welcome contributions! Please see CONTRIBUTING.md for guidelines.
Development Setup
- Fork the repository
- Clone your fork:
git clone https://github.com/yourusername/biopython-mcp.git - Install development dependencies:
pip install -e ".[dev]" - Install pre-commit hooks:
pre-commit install - Create a feature branch:
git checkout -b feature-name - Make your changes and commit
- Run tests:
pytest - Push and create a pull request
Code Quality
We use:
- Black for code formatting
- Ruff for linting
- mypy for type checking
- pytest for testing
- pre-commit for automated checks
Testing
Run tests:
pytest
Run tests with coverage:
pytest --cov=biopython_mcp --cov-report=term-missing
Generate coverage reports (HTML and XML):
pytest --cov=biopython_mcp --cov-report=html --cov-report=xml --cov-report=term-missing
View HTML coverage report:
open htmlcov/index.html # macOS
xdg-open htmlcov/index.html # Linux
start htmlcov/index.html # Windows
Run type checking:
mypy biopython_mcp/
CI/CD Coverage
The project uses GitHub Actions for continuous integration with automatic coverage reporting to Codecov.
Coverage is automatically uploaded when:
- Tests run on Ubuntu with Python 3.11
- Pull requests are created or updated
- Commits are pushed to
mainordevelopbranches
Note for Contributors: Coverage reports are publicly available. The CI workflow uses the CODECOV_TOKEN secret for authenticated uploads. Repository maintainers should configure this secret in GitHub repository settings.
License
This project is licensed under the MIT License - see the LICENSE file for details.
Citation
If you use BioPython MCP in your research, please cite:
@software{biopython_mcp,
title = {BioPython MCP: Model Context Protocol Server for BioPython},
author = {BioPython MCP Contributors},
year = {2026},
url = {https://github.com/kmaneesh/biopython-mcp}
}
Acknowledgments
- Built on the excellent BioPython library
- Uses FastMCP for MCP implementation
- Inspired by the Model Context Protocol
Support
- Issues: GitHub Issues
- Discussions: GitHub Discussions
- Email: Contact maintainers
Roadmap
- Add support for protein secondary structure prediction
- Implement BLAST search integration
- Add sequence feature annotation tools
- Support for custom HMM profiles
- Interactive structure visualization
- Batch processing capabilities
- REST API wrapper
Related Projects
- BioPython - The core library
- Model Context Protocol - The MCP specification
- FastMCP - MCP framework for Python
Made with BioPython and MCP
